Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator MurR in Staphylococcaceae

Properties
Regulator family: RpiR
Regulation mode: repressor
Biological process: N-acetylmuramate utilization
Effector: N-acetylmuramate-6-phosphate
Regulog: MurR - Staphylococcaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Staphylococcus aureus subsp. aureus N315
SA0184 SA0184 -133 5.4 ATATGTAAGATTATTACAATG
Staphylococcus capitis SK14
STACA0001_1175 SA0184 -65 5.3 AATTGTAAACGTTTAATAATA
Staphylococcus epidermidis ATCC 12228
SE1888 SA0184 -66 5.3 AATTGTAAACTTGTTGCAATA
Staphylococcus carnosus subsp. carnosus TM300
Sca_2140 SA0184 -114 5.6 TATTGTAATAAAATTTCAATT
Staphylococcus haemolyticus JCSC1435
SH0743 SA0184 -91 5.6 AATTATAAAAATTATATAATA
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
SSP0596 SA0184 -64 5.6 AATTGTAATACTTTTTCATAT
SSP0596 SA0184 -105 5.3 ATTTGTAATAAAATTTCATTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD