Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Staphylococcus aureus subsp. aureus N315

Properties
Regulator type: Transcription factor
TF locus tag: SA1383
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Staphylococcaceae
Statistics of regulated genes:
- Genes 12
- Operons 8
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 56 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -126
Score: 6.9
Sequence: TAAATAGTAATGATTACGTTTTA
Locus tag: SA2203
Name: SA2203
Funciton: putative MFS family major facilitator transporter
SA2203
putative MFS family major facilitator transporter

Position: -42
Score: 6.4
Sequence: TAAATCGTAACGATTACGCTTTA
Locus tag: SA0806
Name: SA0806
Funciton: hypothetical protein
SA0806
hypothetical protein

Position: -45
Score: 7.1
Sequence: TAAATCGTAATAATTACGATTTG
Locus tag: SA1171
Name: rpsN2
Funciton: 30S ribosomal protein S14
rpsN2
30S ribosomal protein S14

Position: -38
Score: 5.4
Sequence: TAAATCGTAAAGATTCCTAACAA
Locus tag: SAS042
Name: rpmG2
Funciton: 50S ribosomal protein L33
rpmG2
50S ribosomal protein L33

Position: -69
Score: 5.5
Sequence: TGAGTCGTAAACATTACTGTTTA
Locus tag: SA1385
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: SA1384
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: SA1383
Name: zur
Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
znuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
Zinc ABC transporter, inner membrane permease protein ZnuB
zur
Zinc homeostasis transcriptional regulator Zur, Fur family

Position: -34
Score: 6.6
Sequence: TAAAACGTAAAGATTACTATTTA
Locus tag: SA2194
Name: zinT
Funciton: Candidate zinc-binding lipoprotein ZinT
zinT
Candidate zinc-binding lipoprotein ZinT

Position: -50
Score: 6.4
Sequence: TAAAACGGAATTATTCCTATTTA
Locus tag: SA0410
Name: yciC
Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
yciC
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family

Position: -69
Score: 7.4
Sequence: TAAATCGTAATTATTACGATTTA
Locus tag: SA2370
Name: SA2370
Funciton: hypothetical protein
Locus tag: SA2369
Name: SA2369
Funciton: hypothetical protein
Locus tag: SA2368
Name: SA2368
Funciton: hypothetical protein
SA2370
hypothetical protein
SA2369
hypothetical protein
SA2368
hypothetical protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD