Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of YtrA in Staphylococcus aureus subsp. aureus N315

Properties
Regulator type: Transcription factor
TF locus tag: SA1748
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Hypothetical ABC transporter
Effector:
Regulog: YtrA - Staphylococcaceae
Statistics of regulated genes:
- Genes 5
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -42
Score: 6.8
Sequence: TGTGTATATTGTATATATACA
Locus tag: SA1748
Name: ytrA
Funciton: transcription regulator GntR family
Locus tag: SA1747
Name: ytrB
Funciton: ABC transporter (ATP-binding protein)
Locus tag: SA1746
Name: SA1746
Funciton: putative membrane protein
Locus tag: SA1745
Name: SA1745
Funciton: ABC transporter (ATP-binding protein)
Locus tag: SA1744
Name: SA1744
Funciton: putative membrane protein
ytrA
transcription regulator GntR family
ytrB
ABC transporter (ATP-binding protein)
SA1746
putative membrane protein
SA1745
ABC transporter (ATP-binding protein)
SA1744
putative membrane protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD