Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of HisR in Staphylococcus aureus subsp. aureus N315

Properties
Regulator type: Transcription factor
TF locus tag: SA1723
Regulator family: TrpR
Regulation mode: repressor
Biological process: Histidine biosynthesis
Effector: Histidine
Regulog: HisR - Staphylococcaceae
Statistics of regulated genes:
- Genes 13
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 24 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -38
Score: 5
Sequence: CGCTTTAGTTCGATAGAGCG
Locus tag: SA0804
Name: yuiF
Funciton: Histidine permease
Locus tag: SA0805
Name: SA0805
Funciton: putative esterase
yuiF
Histidine permease
SA0805
putative esterase

Position: -27
Score: 5.5
Sequence: CGCTTTAACGCTTTAAAGGA
Locus tag: SA0417
Name: SA0417
Funciton: putative sodium-dependent transporter
SA0417
putative sodium-dependent transporter

Position: -84
Score: 4.7
Sequence: CACTTTAGTGTGGTAGAGAA
Locus tag: SA2472
Name: hisZ
Funciton: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
Locus tag: SA2471
Name: hisG
Funciton: ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
Locus tag: SA2470
Name: hisD
Funciton: Histidinol dehydrogenase (EC 1.1.1.23)
Locus tag: SA2469
Name: hisC
Funciton: Histidinol-phosphate aminotransferase (EC 2.6.1.9)
Locus tag: SA2468
Name: hisB
Funciton: Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
Locus tag: SA2467
Name: hisH
Funciton: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
Locus tag: SA2466
Name: hisA
Funciton: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
Locus tag: SA2465
Name: hisF
Funciton: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
Locus tag: SA2464
Name: hisIE
Funciton: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
hisZ
ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
hisG
ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
hisD
Histidinol dehydrogenase (EC 1.1.1.23)
hisC
Histidinol-phosphate aminotransferase (EC 2.6.1.9)
hisB
Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
hisH
Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
hisA
Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
hisF
Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
hisIE
Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)

Position: -62
Score: 5.2
Sequence: CACTTTAATAGATTAATGCG
Locus tag: SA1723
Name: hisR
Funciton: Predicted histidine repressor, TrpR family
hisR
Predicted histidine repressor, TrpR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD