Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ScrR in Staphylococcus aureus subsp. aureus N315

Properties
Regulator type: Transcription factor
TF locus tag: SA1847
Regulator family: LacI
Regulation mode: repressor
Biological process: Sucrose utilization
Effector: Sucrose-6-phosphate
Regulog: ScrR - Staphylococcaceae
Statistics of regulated genes:
- Genes 3
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 16 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -127
Score: 5.7
Sequence: ATGTGGAACCGATACCATAT
Locus tag: SA1846
Name: scrB
Funciton: sucrose-6-phosphate hydrolase
Locus tag: SA1845
Name: scrK
Funciton: fructokinase
scrB
sucrose-6-phosphate hydrolase
scrK
fructokinase

Position: -63
Score: 6.2
Sequence: TTTTGGAACCGGTTACAATA
Position: -34
Score: 5.7
Sequence: AAATGGAACCGGTTCTAATT
Locus tag: SA2167
Name: scrA
Funciton: PTS system sucrose-specific IIBC component
scrA
PTS system sucrose-specific IIBC component
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD