Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MurR in Staphylococcus aureus subsp. aureus N315

Properties
Regulator type: Transcription factor
TF locus tag: SA0187
Regulator family: RpiR
Regulation mode: repressor
Biological process: N-acetylmuramate utilization
Effector: N-acetylmuramate-6-phosphate
Regulog: MurR - Staphylococcaceae
Statistics of regulated genes:
- Genes 4
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -133
Score: 5.4
Sequence: ATATGTAAGATTATTACAATG
Locus tag: SA0184
Name: SA0184
Funciton: Outer surface protein of unknown function, N-acetylmuramate-related
Locus tag: SA0185
Name: murQ
Funciton: N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-)
Locus tag: SA0186
Name: murT
Funciton: predicted N-acetylmuramate PTS system, IIBC components
Locus tag: SA0187
Name: murR
Funciton: predicted N-acetylmuramate-6-phosphate-responsive transcriptional regulator, RpiR family
SA0184
Outer surface protein of unknown function, N-acetylmuramate-related
murQ
N-acetylmuramic acid 6-phosphate etherase (EC 4.2.-.-)
murT
predicted N-acetylmuramate PTS system, IIBC components
murR
predicted N-acetylmuramate-6-phosphate-responsive transcriptional regulator, RpiR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD