Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MtlR in Staphylococcus aureus subsp. aureus N315

Properties
Regulator type: Transcription factor
TF locus tag: SA1961
Regulator family: BglG
Regulation mode: activator
Biological process: Mannitol utilization
Effector: MtlA, mannitol-specific enzyme IICB PTS component; HPr, phosphocarrier protein
Regulog: MtlR - Staphylococcaceae
Statistics of regulated genes:
- Genes 4
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -104
Score: 6.5
Sequence: TTGTCACATTTATTTTGACAA
Locus tag: SA1960
Name: mtlF
Funciton: mannitol specific PTS system, IIBC component
Locus tag: SA1961
Name: mtlR
Funciton: transcriptional activator of mannitol operon, BglG family
Locus tag: SA1962
Name: mtlA
Funciton: mannitol specific PTS system, IIA component
Locus tag: SA1963
Name: mtlD
Funciton: mannitol-1-phosphate 5-dehydrogenase
mtlF
mannitol specific PTS system, IIBC component
mtlR
transcriptional activator of mannitol operon, BglG family
mtlA
mannitol specific PTS system, IIA component
mtlD
mannitol-1-phosphate 5-dehydrogenase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD