Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of MntR in Staphylococcus aureus subsp. aureus N315

Properties
Regulator type: Transcription factor
TF locus tag: SA0590
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Regulog: MntR - Staphylococcaceae
Statistics of regulated genes:
- Genes 4
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 15 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -67
Score: 6.3
Sequence: AATTTAGGTTGACCTAAACA
Locus tag: SA0956
Name: mntH
Funciton: Mn2+/Fe2+ transporter, NRAMP family
mntH
Mn2+/Fe2+ transporter, NRAMP family

Position: -42
Score: 6.1
Sequence: TAATTAGGTTAGCCTAAACT
Locus tag: SA0589
Name: mntA
Funciton: manganese ABC transport system ATPase component MntA
Locus tag: SA0588
Name: mntB
Funciton: manganese ABC transport system membrane protein MntB
Locus tag: SA0587
Name: mntC
Funciton: manganese ABC transport system substrate-binding protein MntC
mntA
manganese ABC transport system ATPase component MntA
mntB
manganese ABC transport system membrane protein MntB
mntC
manganese ABC transport system substrate-binding protein MntC
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD