Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ManR in Staphylococcus aureus subsp. aureus N315

Properties
Regulator type: Transcription factor
TF locus tag: SA2433
Regulator family: BglG
Regulation mode: activator
Biological process: Mannose utilization
Effector: ManP, mannose-specific enzyme IIBCA PTS component; HPr, phosphocarrier protein
Regulog: ManR - Staphylococcaceae
Statistics of regulated genes:
- Genes 2
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -76
Score: 6.7
Sequence: ATTGCCACTAGTAACGGTAAT
Locus tag: SA2434
Name: manP
Funciton: PTS system, mannose-specific IIB component (EC 2.7.1.69) / PTS system, mannose-specific IIC component (EC 2.7.1.69) / PTS system, mannose-specific IIA component (EC 2.7.1.69)
Locus tag: SA2435
Name: manA
Funciton: Mannose-6-phosphate isomerase (EC 5.3.1.8)
manP
PTS system, mannose-specific IIB component (EC 2.7.1.69) / PTS system, mannose-specific IIC component (EC 2.7.1.69) / PTS system, mannose-specific IIA component (EC 2.7.1.69)
manA
Mannose-6-phosphate isomerase (EC 5.3.1.8)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD