Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of LexA in Staphylococcus aureus subsp. aureus N315

Properties
Regulator type: Transcription factor
TF locus tag: SA1174
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Regulog: LexA - Staphylococcaceae
Statistics of regulated genes:
- Genes 16
- Operons 10
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 85 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -32
Score: 5.3
Sequence: AAACGAACGTACGTTTGCAG
Locus tag: SA1188
Name: parE
Funciton: DNA topoisomerase IV subunit B
Locus tag: SA1189
Name: parC
Funciton: DNA topoisomerase IV subunit A
parE
DNA topoisomerase IV subunit B
parC
DNA topoisomerase IV subunit A

Position: -132
Score: 4.9
Sequence: CCTAGAACATTTGTTTGTAT
Position: -74
Score: 5.6
Sequence: TAACGAACAAATGTTTGTTT
Locus tag: SA1174
Name: lexA
Funciton: SOS regulatory LexA protein
lexA
SOS regulatory LexA protein

Position: -107
Score: 5.4
Sequence: TTACGAACAAACGTTTGCTT
Locus tag: SA0713
Name: uvrB
Funciton: excinuclease ABC subunit B
Locus tag: SA0714
Name: uvrA
Funciton: exinuclease ABC subunit A
uvrB
excinuclease ABC subunit B
uvrA
exinuclease ABC subunit A

Position: -31
Score: 5.3
Sequence: AAGCGAACAAATGTTCTATA
Locus tag: SA1180
Name: sbcD
Funciton: exonuclease SbcD
Locus tag: SA1181
Name: sbcC
Funciton: exonuclease SbcC
sbcD
exonuclease SbcD
sbcC
exonuclease SbcC

Position: -66
Score: 4.9
Sequence: ACCCGAAAATATGTTCGTGT
Locus tag: SA1975
Name: SA1975
Funciton: predicted membrane-bound hydrolase
Locus tag: SA1974
Name: SA1974
Funciton: UDP-N-acetylglucosamine pyrophosphorylase
Locus tag: SA1973
Name: SA1973
Funciton: hemolysin III
SA1975
predicted membrane-bound hydrolase
SA1974
UDP-N-acetylglucosamine pyrophosphorylase
SA1973
hemolysin III

Position: -133
Score: 5.7
Sequence: AACAGAACATATGTTCGTAT
Locus tag: SA1749
Name: SA1749
Funciton: hypothetical protein
SA1749
hypothetical protein

Position: -124
Score: 4.8
Sequence: CACAGAACGTTTGTTCGGTA
Locus tag: SA0684
Name: SA0684
Funciton: putative permease
Locus tag: SA0683
Name: SA0683
Funciton: 7-cyano-7-deazaguanine reductase
SA0684
putative permease
SA0683
7-cyano-7-deazaguanine reductase

Position: -145
Score: 5.1
Sequence: ATAAGCACGTTTGTTCGTTT
Position: -102
Score: 5.4
Sequence: ATACGAACAAATATTCGCAA
Locus tag: SA1128
Name: recA
Funciton: recombinase A
recA
recombinase A

Position: -51
Score: 5.3
Sequence: AACAGAACACATGTTCGTAT
Locus tag: SA1738
Name: null
Funciton: SPBc2 prophage-derived uncharacterized protein
SPBc2 prophage-derived uncharacterized protein

Position: -79
Score: 5
Sequence: AACAGAACATTTGTTCTAAA
Position: -51
Score: 4.8
Sequence: AATAGAACACGTGTTCGTAT
Locus tag: SA1196
Name: uvrX
Funciton: Putative UV-damage repair protein
uvrX
Putative UV-damage repair protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD