Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of IcaR in Staphylococcus aureus subsp. aureus N315

Properties
Regulator type: Transcription factor
TF locus tag: SA2458
Regulator family: TetR
Regulation mode: repressor
Biological process: Intercellular adhesion
Effector:
Regulog: IcaR - Staphylococcaceae
Statistics of regulated genes:
- Genes 5
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -156
Score: 7.2
Sequence: ACCTACCTTTCGTTAGTTAGGT
Locus tag: SA2458
Name: icaR
Funciton: icaADBC operon transcriptional regulator
icaR
icaADBC operon transcriptional regulator

Position: -29
Score: 7.2
Sequence: ACCTAACTAACGAAAGGTAGGT
Locus tag: SA2459
Name: icaA
Funciton: polysaccharide intercellular adhesin biosynthesis N-glycosyltransferase (EC 2.4.-.-)
Locus tag: SA2460
Name: icaD
Funciton: polysaccharide intercellular adhesin biosynthesis protein
Locus tag: SA2461
Name: icaB
Funciton: polysaccharide intercellular adhesin biosynthesis deacetylase (EC 3.-.-.-)
Locus tag: SA2462
Name: icaC
Funciton: polysaccharide intercellular adhesin biosynthesis protein
icaA
polysaccharide intercellular adhesin biosynthesis N-glycosyltransferase (EC 2.4.-.-)
icaD
polysaccharide intercellular adhesin biosynthesis protein
icaB
polysaccharide intercellular adhesin biosynthesis deacetylase (EC 3.-.-.-)
icaC
polysaccharide intercellular adhesin biosynthesis protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD