Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of HrcA in Staphylococcus aureus subsp. aureus N315

Properties
Regulator type: Transcription factor
TF locus tag: SA1411
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Staphylococcaceae
Statistics of regulated genes:
- Genes 6
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -54
Score: 6.9
Sequence: TTAGCACTCTTTAATGTTAAGTGCTAA
Locus tag: SA1837
Name: groES
Funciton: chaperonin GroES protein
Locus tag: SA1836
Name: groEL
Funciton: chaperonin GroEL protein
groES
chaperonin GroES protein
groEL
chaperonin GroEL protein

Position: -38
Score: 6.8
Sequence: TTAGCACTTGAGATAAGTGAGTGCTAA
Locus tag: SA1411
Name: hrcA
Funciton: heat-inducible transcription repressor HrcA
Locus tag: SA1410
Name: grpE
Funciton: heat shock molecular chaperone protein GrpE
Locus tag: SA1409
Name: dnaK
Funciton: chaperone protein DnaK
Locus tag: SA1408
Name: dnaJ
Funciton: chaperone protein dnaJ
hrcA
heat-inducible transcription repressor HrcA
grpE
heat shock molecular chaperone protein GrpE
dnaK
chaperone protein DnaK
dnaJ
chaperone protein dnaJ
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD