Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of GlvR in Staphylococcus aureus subsp. aureus N315

Properties
Regulator type: Transcription factor
TF locus tag: SA2115
Regulator family: RpiR
Regulation mode: activator
Biological process: Maltose utilization
Effector: Maltose-6-phosphate
Regulog: GlvR - Staphylococcaceae
Statistics of regulated genes:
- Genes 1
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -181
Score: 7.6
Sequence: TGAAAAAATTTTCACTATATGAAAA
Locus tag: SA2114
Name: glvC
Funciton: maltose-specific PTS system, IIBC component
glvC
maltose-specific PTS system, IIBC component
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD