Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of FruR in Staphylococcus aureus subsp. aureus N315

Properties
Regulator type: Transcription factor
TF locus tag: SA0653
Regulator family: DeoR
Regulation mode: repressor
Biological process: Fructose utilization
Effector: Fructose-6-phosphate
Regulog: FruR - Staphylococcaceae
Statistics of regulated genes:
- Genes 3
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 18 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -83
Score: 4.9
Sequence: TGGGTGTTTGTGATTGTTTT
Position: -73
Score: 5.3
Sequence: TGATTGTTTTTGGTAATTTA
Position: -63
Score: 5.6
Sequence: TGGTAATTTATGATTGAAAA
Locus tag: SA0653
Name: fruR
Funciton: Transcriptional repressor of the fructose operon, DeoR family
Locus tag: SA0654
Name: fruB
Funciton: 1-phosphofructokinase (EC 2.7.1.56)
Locus tag: SA0655
Name: fruA
Funciton: PTS system, fructose-specific IIA component (EC 2.7.1.69) / PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69)
fruR
Transcriptional repressor of the fructose operon, DeoR family
fruB
1-phosphofructokinase (EC 2.7.1.56)
fruA
PTS system, fructose-specific IIA component (EC 2.7.1.69) / PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD