Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CzrA in Staphylococcus aureus subsp. aureus N315

Properties
Regulator type: Transcription factor
TF locus tag: SA1947
Regulator family: ArsR
Regulation mode: repressor
Biological process: Zinc resistance
Effector: Zinc ion, (Zn2+)
Regulog: CzrA - Staphylococcaceae
Statistics of regulated genes:
- Genes 2
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -40
Score: 7.3
Sequence: AATATATGAACAAATATTCATATGAA
Locus tag: SA1947
Name: czrA
Funciton: zinc resistance repressor
Locus tag: SA1948
Name: czrB
Funciton: zinc resistance efflux pump
czrA
zinc resistance repressor
czrB
zinc resistance efflux pump
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD