Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CggR in Staphylococcus aureus subsp. aureus N315

Properties
Regulator type: Transcription factor
TF locus tag: SA0726
Regulator family: SorC
Regulation mode: repressor
Biological process: Glycolysis
Effector: Fructose-1,6-diphosphate
Regulog: CggR - Staphylococcaceae
Statistics of regulated genes:
- Genes 6
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -85
Score: 6.9
Sequence: TTTTGTCCCACGCGGGACTTAA
Locus tag: SA0726
Name: cggR
Funciton: Transcriptional regulator of central glycolytic gene, SorC family
Locus tag: SA0727
Name: gap
Funciton: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
Locus tag: SA0728
Name: pgk
Funciton: Phosphoglycerate kinase (EC 2.7.2.3)
Locus tag: SA0729
Name: tpiA
Funciton: Triosephosphate isomerase (EC 5.3.1.1)
Locus tag: SA0730
Name: pgm
Funciton: 2,3-bisphosphoglycerate-independent phosphoglycerate mutase (EC 5.4.2.1)
Locus tag: SA0731
Name: eno
Funciton: Enolase (EC 4.2.1.11)
cggR
Transcriptional regulator of central glycolytic gene, SorC family
gap
NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
pgk
Phosphoglycerate kinase (EC 2.7.2.3)
tpiA
Triosephosphate isomerase (EC 5.3.1.1)
pgm
2,3-bisphosphoglycerate-independent phosphoglycerate mutase (EC 5.4.2.1)
eno
Enolase (EC 4.2.1.11)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD