Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of BirA in Staphylococcus aureus subsp. aureus N315

Properties
Regulator type: Transcription factor
TF locus tag: SA1289
Regulator family: BirA
Regulation mode: repressor
Biological process: Biotin biosynthesis
Effector: Biotin
Regulog: BirA - Staphylococcaceae
Statistics of regulated genes:
- Genes 12
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 21 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -48
Score: 7.1
Sequence: AATGTTAACAAGATGTATTTTAAAGTTTACATT
Locus tag: SA0533
Name: yhfT
Funciton: putative long chain fatty acid-CoA ligase
Locus tag: SA0534
Name: yhfS
Funciton: putative acetyl-CoA c-acetyltransferase
Locus tag: SA0535
Name: SA0535
Funciton: hypothetical protein
Locus tag: SA0536
Name: SA0536
Funciton: hypothetical protein
yhfT
putative long chain fatty acid-CoA ligase
yhfS
putative acetyl-CoA c-acetyltransferase
SA0535
hypothetical protein
SA0536
hypothetical protein

Position: -75
Score: 7.5
Sequence: ATTGTAAACTTTTCATTTCTTAAAGTTTACAAT
Locus tag: SA2077
Name: bioY
Funciton: biotin transporter BioY
Locus tag: SA2076
Name: SA2076
Funciton: putative acetyltransferase
bioY
biotin transporter BioY
SA2076
putative acetyltransferase

Position: -55
Score: 7.9
Sequence: AATGTAAACTTATTAATTATAAAAGTTTACATT
Locus tag: SA2215
Name: bioD
Funciton: dethiobiotin synthetase
Locus tag: SA2214
Name: bioA
Funciton: adenosylmethionine-8-amino-7-oxononanoate aminotransferase
Locus tag: SA2213
Name: bioB
Funciton: biotin synthase
Locus tag: SA2212
Name: bioF
Funciton: hypothetical protein
Locus tag: SA2211
Name: bioW
Funciton: hypothetical protein
Locus tag: SA2210
Name: bioX
Funciton: hypothetical protein
bioD
dethiobiotin synthetase
bioA
adenosylmethionine-8-amino-7-oxononanoate aminotransferase
bioB
biotin synthase
bioF
hypothetical protein
bioW
hypothetical protein
bioX
hypothetical protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD