Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of NagR in Oenococcus oeni PSU-1

Properties
Regulator type: Transcription factor
TF locus tag: OEOE_1727
Regulator family: GntR/Others
Regulation mode:
Biological process: N-acetylglucosamine utilization
Effector: N-acetylglucosamine-6-phosphate
Regulog: NagR - Lactobacillaceae
Statistics of regulated genes:
- Genes 5
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 79 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -84
Score: 4.2
Sequence: CAAAAAAACTATACCAATTT
Locus tag: OEOE_0644
Name: nagB
Funciton: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
nagB
Glucosamine-6-phosphate deaminase (EC 3.5.99.6)

Position: -113
Score: 5
Sequence: TTAATGGCCTATACCAATGT
Locus tag: OEOE_0635
Name: glmS
Funciton: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
Locus tag: OEOE_0636
Name: pgi
Funciton: Glucose-6-phosphate isomerase (EC 5.3.1.9)
glmS
Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
pgi
Glucose-6-phosphate isomerase (EC 5.3.1.9)

Position: -32
Score: 4.4
Sequence: TAATTGGGCTATACCAAACC
Locus tag: OEOE_1728
Name: nagA
Funciton: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
Locus tag: OEOE_1727
Name: nagR
Funciton: Transcriptional regulator of N-Acetylglucosamine utilization, GntR family
nagA
N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
nagR
Transcriptional regulator of N-Acetylglucosamine utilization, GntR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD