Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of NagR in Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Properties
Regulator type: Transcription factor
TF locus tag: LEUM_0426
Regulator family: GntR/Others
Regulation mode:
Biological process: N-acetylglucosamine utilization
Effector: N-acetylglucosamine-6-phosphate
Regulog: NagR - Lactobacillaceae
Statistics of regulated genes:
- Genes 4
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 79 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -50
Score: 5.4
Sequence: ATATTGGTATAGACCAAAAC
Position: -35
Score: 5.8
Sequence: AAAACGGTATAGACCAATTT
Locus tag: LEUM_0354
Name: nagB
Funciton: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
Locus tag: LEUM_0355
Name: pgi
Funciton: Glucose-6-phosphate isomerase (EC 5.3.1.9)
nagB
Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
pgi
Glucose-6-phosphate isomerase (EC 5.3.1.9)

Position: -82
Score: 5.8
Sequence: TAATAGGTCTAGACCAATTA
Locus tag: LEUM_0425
Name: nagA
Funciton: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
Locus tag: LEUM_0426
Name: nagR
Funciton: Transcriptional regulator of N-Acetylglucosamine utilization, GntR family
nagA
N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
nagR
Transcriptional regulator of N-Acetylglucosamine utilization, GntR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD