Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of NagR in Lactobacillus reuteri JCM 1112

Properties
Regulator type: Transcription factor
TF locus tag: LAR_0271
Regulator family: GntR/Others
Regulation mode:
Biological process: N-acetylglucosamine utilization
Effector: N-acetylglucosamine-6-phosphate
Regulog: NagR - Lactobacillaceae
Statistics of regulated genes:
- Genes 2
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 79 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -82
Score: 4.2
Sequence: AAATTGGTCTAGATTTTTGG
Locus tag: LAR_0271
Name: nagR
Funciton: Transcriptional regulator of N-Acetylglucosamine utilization, GntR family
nagR
Transcriptional regulator of N-Acetylglucosamine utilization, GntR family

Position: -134
Score: 4.4
Sequence: TAAATCATATAGACCAATCT
Position: -43
Score: 4.4
Sequence: CTAGTTATCTATACCAATTT
Locus tag: LAR_0405
Name: glmS
Funciton: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
glmS
Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD