Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of NagR in Lactobacillus plantarum WCFS1

Properties
Regulator type: Transcription factor
TF locus tag: lp_0563
Regulator family: GntR/Others
Regulation mode:
Biological process: N-acetylglucosamine utilization
Effector: N-acetylglucosamine-6-phosphate
Regulog: NagR - Lactobacillaceae
Statistics of regulated genes:
- Genes 6
- Operons 5
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 79 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -60
Score: 5.4
Sequence: ATTTTAGTCTAGACCAATAT
Position: -39
Score: 4.8
Sequence: CAATTGGACTATACCAAACA
Locus tag: lp_0226
Name: nagB
Funciton: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
nagB
Glucosamine-6-phosphate deaminase (EC 3.5.99.6)

Position: -100
Score: 4.2
Sequence: ACATTGGTCTATACACTTAG
Locus tag: lp_2531
Name: nagE
Funciton: N-acetylglucosamine and glucose PTS, EIICBA
nagE
N-acetylglucosamine and glucose PTS, EIICBA

Position: -97
Score: 5
Sequence: CCAATGGACTATACCAATAA
Locus tag: lp_2969
Name: nagE
Funciton: N-acetylglucosamine and glucose PTS, EIICBA
nagE
N-acetylglucosamine and glucose PTS, EIICBA

Position: -55
Score: 5.2
Sequence: AGTTTGGTCTATACCGATTA
Locus tag: lp_0562
Name: nagA
Funciton: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
Locus tag: lp_0563
Name: nagR
Funciton: Transcriptional regulator of N-Acetylglucosamine utilization, GntR family
nagA
N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
nagR
Transcriptional regulator of N-Acetylglucosamine utilization, GntR family

Position: -213
Score: 4.1
Sequence: AGGTTAGACTAGACCAATTG
Locus tag: lp_0822
Name: glmS
Funciton: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
glmS
Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD