Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of NagR in Lactobacillus johnsonii NCC 533

Properties
Regulator type: Transcription factor
TF locus tag: LJ1739
Regulator family: GntR/Others
Regulation mode:
Biological process: N-acetylglucosamine utilization
Effector: N-acetylglucosamine-6-phosphate
Regulog: NagR - Lactobacillaceae
Statistics of regulated genes:
- Genes 5
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 79 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -65
Score: 5.4
Sequence: TAATTTGACTAGACCAATTT
Position: -37
Score: 5.4
Sequence: ATAATGGACTAGACCAATGA
Locus tag: LJ1823
Name: nagB
Funciton: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
nagB
Glucosamine-6-phosphate deaminase (EC 3.5.99.6)

Position: -109
Score: 5.4
Sequence: TCATTGGTCTAGTCCATTAT
Position: -81
Score: 5.4
Sequence: AAATTGGTCTAGTCAAATTA
Locus tag: LJ1822
Name: PF00248
Funciton: Oxidoreductase, aldo/keto reductase family
PF00248
Oxidoreductase, aldo/keto reductase family

Position: -64
Score: 5.8
Sequence: AAATAGGTATATACCAATTA
Locus tag: LJ0531
Name: null
Funciton: PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
Locus tag: LJ0532
Name: null
Funciton: hypothetical protein
PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
hypothetical protein

Position: -130
Score: 5.1
Sequence: CTTTTGATATAGACCAATTA
Position: -29
Score: 4.4
Sequence: TAAATGAACTATACCAAAGG
Locus tag: LJ1581
Name: glmS
Funciton: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
glmS
Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD