Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of NagR in Lactobacillus helveticus DPC 4571

Properties
Regulator type: Transcription factor
TF locus tag: lhv_0534
Regulator family: GntR/Others
Regulation mode:
Biological process: N-acetylglucosamine utilization
Effector: N-acetylglucosamine-6-phosphate
Regulog: NagR - Lactobacillaceae
Statistics of regulated genes:
- Genes 4
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 79 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -103
Score: 5.3
Sequence: TTACTGGTCTAGTCCATTAT
Position: -83
Score: 5.6
Sequence: AAAATGGAATAGACCATTTT
Locus tag: lhv_2076
Name: PF00248
Funciton: Oxidoreductase, aldo/keto reductase family
PF00248
Oxidoreductase, aldo/keto reductase family

Position: -35
Score: 4.5
Sequence: AATGCAATCTAGACCAATTT
Locus tag: lhv_0534
Name: nagR
Funciton: Transcriptional regulator of N-Acetylglucosamine utilization, GntR family
nagR
Transcriptional regulator of N-Acetylglucosamine utilization, GntR family

Position: -54
Score: 5.6
Sequence: AAAATGGTCTATTCCATTTT
Position: -34
Score: 5.3
Sequence: ATAATGGACTAGACCAGTAA
Locus tag: lhv_2077
Name: nagB
Funciton: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
nagB
Glucosamine-6-phosphate deaminase (EC 3.5.99.6)

Position: -131
Score: 4.9
Sequence: AAAATTGATTATACCAATTT
Locus tag: lhv_0491
Name: glmS
Funciton: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
glmS
Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD