Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of NagR in Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Properties
Regulator type: Transcription factor
TF locus tag: LBUL_0399
Regulator family: GntR/Others
Regulation mode:
Biological process: N-acetylglucosamine utilization
Effector: N-acetylglucosamine-6-phosphate
Regulog: NagR - Lactobacillaceae
Statistics of regulated genes:
- Genes 4
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 79 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -85
Score: 4.6
Sequence: AAACTGGTATAGGCTATTTT
Locus tag: LBUL_0170
Name: LBA0143
Funciton: Maltodextrin glucosidase (EC 3.2.1.20)
LBA0143
Maltodextrin glucosidase (EC 3.2.1.20)

Position: -166
Score: 5.7
Sequence: ATATTGGTATAGTCCATTTT
Position: -127
Score: 4.5
Sequence: GTCAAGGTCTAGACCGATAA
Locus tag: LBUL_2009
Name: PF00248
Funciton: Oxidoreductase, aldo/keto reductase family
PF00248
Oxidoreductase, aldo/keto reductase family

Position: -92
Score: 4.5
Sequence: TTATCGGTCTAGACCTTGAC
Position: -53
Score: 5.7
Sequence: AAAATGGACTATACCAATAT
Locus tag: LBUL_2010
Name: nagB
Funciton: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
nagB
Glucosamine-6-phosphate deaminase (EC 3.5.99.6)

Position: -29
Score: 4.7
Sequence: AAATTGAACTAGACCAAAGG
Locus tag: LBUL_0440
Name: glmS
Funciton: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
glmS
Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD