Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of NagR in Lactobacillus acidophilus NCFM

Properties
Regulator type: Transcription factor
TF locus tag: LBA0516
Regulator family: GntR/Others
Regulation mode:
Biological process: N-acetylglucosamine utilization
Effector: N-acetylglucosamine-6-phosphate
Regulog: NagR - Lactobacillaceae
Statistics of regulated genes:
- Genes 8
- Operons 7
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 79 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -80
Score: 5.2
Sequence: AAACTGGTATTGACCAATTT
Locus tag: LBA0144
Name: nagA2
Funciton: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
nagA2
N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)

Position: -95
Score: 5.2
Sequence: AAATTGGTCAATACCAGTTT
Locus tag: LBA0143
Name: LBA0143
Funciton: Maltodextrin glucosidase (EC 3.2.1.20)
LBA0143
Maltodextrin glucosidase (EC 3.2.1.20)

Position: -102
Score: 5.4
Sequence: TTAATGGTCTAGTCCATTAT
Position: -82
Score: 5.6
Sequence: AAAATGGAATAGACCATTTT
Locus tag: LBA1947
Name: PF00248
Funciton: Oxidoreductase, aldo/keto reductase family
PF00248
Oxidoreductase, aldo/keto reductase family

Position: -60
Score: 4.9
Sequence: ATAGAGGTATATACCGAATT
Locus tag: LBA0491
Name: celB
Funciton: PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
Locus tag: LBA0492
Name: null
Funciton: hypothetical protein
celB
PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
hypothetical protein

Position: -66
Score: 4.4
Sequence: AATGAAATCTAGACCAATTT
Locus tag: LBA0516
Name: nagR
Funciton: Transcriptional regulator of N-Acetylglucosamine utilization, GntR family
nagR
Transcriptional regulator of N-Acetylglucosamine utilization, GntR family

Position: -52
Score: 4.4
Sequence: AAAATAAACTAGTCCATTAA
Position: -28
Score: 4.6
Sequence: ATATTGAACTAGACCAAAGG
Locus tag: LBA0462
Name: glmS
Funciton: Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)
glmS
Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] (EC 2.6.1.16)

Position: -57
Score: 5.6
Sequence: AAAATGGTCTATTCCATTTT
Position: -37
Score: 5.4
Sequence: ATAATGGACTAGACCATTAA
Locus tag: LBA1948
Name: nagB
Funciton: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
nagB
Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD