Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of YhcF in Lactobacillus helveticus DPC 4571

Properties
Regulator type: Transcription factor
TF locus tag: lhv_1290
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Regulog: YhcF - Lactobacillaceae
Statistics of regulated genes:
- Genes 7
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -44
Score: 5.5
Sequence: AGTGTAATAGACATGTAATACAGC
Locus tag: lhv_1290
Name: yhcF
Funciton: Transcriptional regulator, GntR family
Locus tag: lhv_1289
Name: yhcG
Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: lhv_1288
Name: yhcI
Funciton: ABC-type multidrug transport system, permease component
Locus tag: lhv_1287
Name: yhcI2
Funciton: ABC-type multidrug transport system, permease component
Locus tag: lhv_1286
Name: yhcI3
Funciton: ABC-type multidrug transport system, permease component
yhcF
Transcriptional regulator, GntR family
yhcG
ABC-type multidrug transport system, ATPase component
yhcI
ABC-type multidrug transport system, permease component
yhcI2
ABC-type multidrug transport system, permease component
yhcI3
ABC-type multidrug transport system, permease component

Position: -56
Score: 5.5
Sequence: AGTGTATTGAGTTAATAATACAGT
Locus tag: lhv_1774
Name: ytsC
Funciton: Putative antimicrobial peptide ABC exporter, ATP-binding subunit
Locus tag: lhv_1773
Name: ytsB
Funciton: ABC-type antimicrobial peptide transport system, permease component
ytsC
Putative antimicrobial peptide ABC exporter, ATP-binding subunit
ytsB
ABC-type antimicrobial peptide transport system, permease component
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD