Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of YhcF in Lactobacillus casei ATCC 334

Properties
Regulator type: Transcription factor
TF locus tag: LSEI_1880
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Regulog: YhcF - Lactobacillaceae
Statistics of regulated genes:
- Genes 3
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -40
Score: 6.9
Sequence: AGTGTATTAGTAATCTAATACACT
Locus tag: LSEI_1880
Name: yhcF
Funciton: Transcriptional regulator, GntR family
Locus tag: LSEI_1881
Name: yhcG
Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: LSEI_1882
Name: yhcI
Funciton: ABC-type multidrug transport system, permease component
yhcF
Transcriptional regulator, GntR family
yhcG
ABC-type multidrug transport system, ATPase component
yhcI
ABC-type multidrug transport system, permease component
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD