Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Caur_3587 in Roseiflexus castenholzii DSM 13941

Properties
Regulator type: Transcription factor
TF locus tag: Rcas_2310
Regulator family: ArsR
Regulation mode: repressor
Biological process:
Effector:
Regulog: Caur_3587 - Chloroflexia
Statistics of regulated genes:
- Genes 3
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -252
Score: 5.6
Sequence: ATATCGATGATCATCAATAC
Locus tag: Rcas_2311
Name: PF0583
Funciton: GCN5-related N-acetyltransferase (GNAT) domain
Locus tag: Rcas_2312
Name: ubiE
Funciton: SAM-dependent methyltransferase DSY4148 (UbiE paralog)
PF0583
GCN5-related N-acetyltransferase (GNAT) domain
ubiE
SAM-dependent methyltransferase DSY4148 (UbiE paralog)

Position: -52
Score: 6.6
Sequence: ATATTGACAATCTTCAATAT
Locus tag: Rcas_2310
Name: Caur_3587
Funciton: transcriptional regulator, ArsR family
Caur_3587
transcriptional regulator, ArsR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD