Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Caur_3587 in Herpetosiphon aurantiacus ATCC 23779

Properties
Regulator type: Transcription factor
TF locus tag: Haur_0112
Regulator family: ArsR
Regulation mode: repressor
Biological process:
Effector:
Regulog: Caur_3587 - Chloroflexia
Statistics of regulated genes:
- Genes 5
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -188
Score: 5.9
Sequence: ATATTGATTTTTTTCAATCT
Position: -41
Score: 6.3
Sequence: ATATTGAAAATTTTCAATTT
Locus tag: Haur_2824
Name: PF07992
Funciton: FAD-dependent pyridine nucleotide-disulphide oxidoreductase
Locus tag: Haur_2823
Name: MFS
Funciton: transporter, major facilitator superfamily (MFS)
PF07992
FAD-dependent pyridine nucleotide-disulphide oxidoreductase
MFS
transporter, major facilitator superfamily (MFS)

Position: -50
Score: 5.5
Sequence: ATATTGAATTAATTCGATAA
Locus tag: Haur_0112
Name: Caur_3587
Funciton: transcriptional regulator, ArsR family
Locus tag: Haur_0111
Name: PF0583
Funciton: GCN5-related N-acetyltransferase (GNAT) domain
Locus tag: Haur_0110
Name: ubiE
Funciton: SAM-dependent methyltransferase DSY4148 (UbiE paralog)
Caur_3587
transcriptional regulator, ArsR family
PF0583
GCN5-related N-acetyltransferase (GNAT) domain
ubiE
SAM-dependent methyltransferase DSY4148 (UbiE paralog)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD