Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Caur_3587 in Chloroflexus sp. Y-400-fl

Properties
Regulator type: Transcription factor
TF locus tag: Chy400_3868
Regulator family: ArsR
Regulation mode: repressor
Biological process:
Effector:
Regulog: Caur_3587 - Chloroflexia
Statistics of regulated genes:
- Genes 4
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -60
Score: 6.6
Sequence: ATATTGACAATCTTCAATAT
Locus tag: Chy400_3868
Name: Caur_3587
Funciton: transcriptional regulator, ArsR family
Caur_3587
transcriptional regulator, ArsR family

Position: -43
Score: 6
Sequence: ATATCGATGATCTTCGATAT
Locus tag: Chy400_3867
Name: PF07992
Funciton: FAD-dependent pyridine nucleotide-disulphide oxidoreductase
Locus tag: Chy400_3866
Name: MFS
Funciton: transporter, major facilitator superfamily (MFS)
Locus tag: Chy400_3865
Name: PF07992
Funciton: FAD-dependent pyridine nucleotide-disulphide oxidoreductase
PF07992
FAD-dependent pyridine nucleotide-disulphide oxidoreductase
MFS
transporter, major facilitator superfamily (MFS)
PF07992
FAD-dependent pyridine nucleotide-disulphide oxidoreductase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD