Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Caur_3401 in Chloroflexus aggregans DSM 9485

Properties
Regulator type: Transcription factor
TF locus tag: Cagg_0356
Regulator family: TetR
Regulation mode: repressor
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Regulog: Caur_3401 - Chloroflexia
Statistics of regulated genes:
- Genes 3
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -69
Score: 7
Sequence: ACTTTACGGTATAGTAAAAA
Locus tag: Cagg_0354
Name: acrB
Funciton: Probable multidrug efflux system from RND family, AcrB pore domain
Locus tag: Cagg_0355
Name: hlyD
Funciton: secretion protein HlyD family protein
Locus tag: Cagg_0356
Name: Caur_3401
Funciton: Predicted transcriptional regulator of multidrug efflux transporter, TetR family
acrB
Probable multidrug efflux system from RND family, AcrB pore domain
hlyD
secretion protein HlyD family protein
Caur_3401
Predicted transcriptional regulator of multidrug efflux transporter, TetR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD