Regulon of AcrR in Roseiflexus sp. RS-1
| Regulator type: | Transcription factor |
| TF locus tag: | RoseRS_0266 |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Multidrug efflux; Multidrug resistance |
| Effector: | |
| Regulog: | AcrR - Chloroflexia |
| Statistics of regulated genes: | |
| - Genes | 4 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Chloroflexi
- By TF family - TetR
- By pathway - Multidrug efflux
- By pathway - Multidrug resistance
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -94
Score: 6.7 Sequence: ATTCCTGACCGTTCGGTAAAGTGG
Locus tag: RoseRS_0266
Name: acrR Funciton: Predicted transcriptional regulator of multidrug efflux transporter, TetR family
Locus tag: RoseRS_0267
Name: acrA Funciton: Probable multidrug efflux system from RND family, membrane fusion protein
Locus tag: RoseRS_0268
Name: salX Funciton: ABC transporter related protein SalX
Locus tag: RoseRS_0269
Name: salY Funciton: Putative cell division protein SalY |
|||
|
acrR
|
Predicted transcriptional regulator of multidrug efflux transporter, TetR family
|
||
|
acrA
|
Probable multidrug efflux system from RND family, membrane fusion protein
|
||
|
salX
|
ABC transporter related protein SalX
|
||
|
salY
|
Putative cell division protein SalY
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |