Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of AcrR in Roseiflexus sp. RS-1

Properties
Regulator type: Transcription factor
TF locus tag: RoseRS_0266
Regulator family: TetR
Regulation mode: repressor
Biological process: Multidrug efflux; Multidrug resistance
Effector:
Regulog: AcrR - Chloroflexia
Statistics of regulated genes:
- Genes 4
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -94
Score: 6.7
Sequence: ATTCCTGACCGTTCGGTAAAGTGG
Locus tag: RoseRS_0266
Name: acrR
Funciton: Predicted transcriptional regulator of multidrug efflux transporter, TetR family
Locus tag: RoseRS_0267
Name: acrA
Funciton: Probable multidrug efflux system from RND family, membrane fusion protein
Locus tag: RoseRS_0268
Name: salX
Funciton: ABC transporter related protein SalX
Locus tag: RoseRS_0269
Name: salY
Funciton: Putative cell division protein SalY
acrR
Predicted transcriptional regulator of multidrug efflux transporter, TetR family
acrA
Probable multidrug efflux system from RND family, membrane fusion protein
salX
ABC transporter related protein SalX
salY
Putative cell division protein SalY
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD