Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of BfrR in Chloroflexus sp. Y-400-fl

Properties
Regulator type: Transcription factor
TF locus tag: Chy400_2954
Regulator family: LacI
Regulation mode: repressor
Biological process: Fructooligosaccharides utilization
Effector:
Regulog: BfrR - Chloroflexia
Statistics of regulated genes:
- Genes 5
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -46
Score: 6.2
Sequence: GTCAATGAACGACCAATCTC
Locus tag: Chy400_2954
Name: bfrR
Funciton: Predicted transcriptional regulator for fructooligosaccharides utilization, LacI family
Locus tag: Chy400_2953
Name: bfrE
Funciton: Fructooligosaccharides ABC transporter, substrate-binding protein
Locus tag: Chy400_2952
Name: bfrF
Funciton: Fructooligosaccharides ABC transporter, permease protein 1
Locus tag: Chy400_2951
Name: bfrG
Funciton: Fructooligosaccharides ABC transporter, permease protein 2
Locus tag: Chy400_2950
Name: bfrA
Funciton: Beta-fructosidases (EC 3.2.1.26)
bfrR
Predicted transcriptional regulator for fructooligosaccharides utilization, LacI family
bfrE
Fructooligosaccharides ABC transporter, substrate-binding protein
bfrF
Fructooligosaccharides ABC transporter, permease protein 1
bfrG
Fructooligosaccharides ABC transporter, permease protein 2
bfrA
Beta-fructosidases (EC 3.2.1.26)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD