Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of RhmR in Chloroflexus sp. Y-400-fl

Properties
Regulator type: Transcription factor
TF locus tag: Chy400_0392
Regulator family: LacI
Regulation mode: repressor
Biological process: Rhamnose oligosaccharides utilization
Effector:
Regulog: RhmR - Chloroflexia
Statistics of regulated genes:
- Genes 5
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 1 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -177
Score: 5.7
Sequence: CATACCGATCGATGCCCAGG
Locus tag: Chy400_0391
Name: rhmE
Funciton: Predicted rhamnose oligosaccharide ABC transporter, extracellular solute-binding component
Locus tag: Chy400_0390
Name: rhmF
Funciton: Predicted rhamnose oligosaccharide ABC transporter, inner membrane component
Locus tag: Chy400_0389
Name: rhmG
Funciton: Predicted rhamnose oligosaccharide ABC transporter, inner membrane component
Locus tag: Chy400_0388
Name: rhmA
Funciton: alpha-L-rhamnosidase
Locus tag: Chy400_0387
Name: GH1
Funciton: glycoside hydrolase family 1
rhmE
Predicted rhamnose oligosaccharide ABC transporter, extracellular solute-binding component
rhmF
Predicted rhamnose oligosaccharide ABC transporter, inner membrane component
rhmG
Predicted rhamnose oligosaccharide ABC transporter, inner membrane component
rhmA
alpha-L-rhamnosidase
GH1
glycoside hydrolase family 1
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD