Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of KojR in Chloroflexus sp. Y-400-fl

Properties
Regulator type: Transcription factor
TF locus tag: Chy400_2182
Regulator family: LacI
Regulation mode: repressor
Biological process: Kojibiose utilization
Effector: Kojibiose
Regulog: KojR - Chloroflexia
Statistics of regulated genes:
- Genes 6
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -84
Score: 6.5
Sequence: CCAGGCGAACGTTCGCTTTT
Position: -30
Score: 6.5
Sequence: AAAAGCGAACGTTCGCCTAG
Locus tag: Chy400_2182
Name: kojR
Funciton: Predicted transcriptional regulator for kojibiose utilization, LacI family
Locus tag: Chy400_2181
Name: kojE
Funciton: Kojibiose ABC transporter, substrate-binding protein
Locus tag: Chy400_2180
Name: kojF
Funciton: Kojibiose ABC transporter, permease protein 1
Locus tag: Chy400_2179
Name: kojG
Funciton: Kojibiose ABC transporter, permease protein 2
Locus tag: Chy400_2178
Name: kojP
Funciton: Kojibiose phosphorylase (EC 2.4.1.230)
Locus tag: Chy400_2177
Name: pgmB
Funciton: Beta-phosphoglucomutase (EC 5.4.2.6)
kojR
Predicted transcriptional regulator for kojibiose utilization, LacI family
kojE
Kojibiose ABC transporter, substrate-binding protein
kojF
Kojibiose ABC transporter, permease protein 1
kojG
Kojibiose ABC transporter, permease protein 2
kojP
Kojibiose phosphorylase (EC 2.4.1.230)
pgmB
Beta-phosphoglucomutase (EC 5.4.2.6)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD