Regulon of NagR in Roseiflexus sp. RS-1
| Regulator type: | Transcription factor |
| TF locus tag: | RoseRS_4247 |
| Regulator family: | ROK |
| Regulation mode: | |
| Biological process: | N-acetylglucosamine utilization |
| Effector: | N-acetylglucosamine |
| Regulog: | NagR - Chloroflexia |
| Statistics of regulated genes: | |
| - Genes | 2 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Chloroflexi
- By TF family - ROK
- By effector - N-acetylglucosamine
- By pathway - N-acetylglucosamine utilization
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -126
Score: 6.7 Sequence: TTGTCAGTTCACTGAACTAATGA
Locus tag: RoseRS_4247
Name: nagR Funciton: Predicted N-acetyl-glucosamine repressor, ROK family
Locus tag: RoseRS_4248
Name: Rcas_0478 Funciton: Predicted N-acetylglucosamine ABC transporter, sugar-binding component |
|||
|
nagR
|
Predicted N-acetyl-glucosamine repressor, ROK family
|
||
|
Rcas_0478
|
Predicted N-acetylglucosamine ABC transporter, sugar-binding component
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |