Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of NagR in Roseiflexus sp. RS-1

Properties
Regulator type: Transcription factor
TF locus tag: RoseRS_4247
Regulator family: ROK
Regulation mode:
Biological process: N-acetylglucosamine utilization
Effector: N-acetylglucosamine
Regulog: NagR - Chloroflexia
Statistics of regulated genes:
- Genes 2
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -126
Score: 6.7
Sequence: TTGTCAGTTCACTGAACTAATGA
Locus tag: RoseRS_4247
Name: nagR
Funciton: Predicted N-acetyl-glucosamine repressor, ROK family
Locus tag: RoseRS_4248
Name: Rcas_0478
Funciton: Predicted N-acetylglucosamine ABC transporter, sugar-binding component
nagR
Predicted N-acetyl-glucosamine repressor, ROK family
Rcas_0478
Predicted N-acetylglucosamine ABC transporter, sugar-binding component
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD