Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of NagR in Herpetosiphon aurantiacus ATCC 23779

Properties
Regulator type: Transcription factor
TF locus tag: Haur_1182
Regulator family: ROK
Regulation mode:
Biological process: N-acetylglucosamine utilization
Effector: N-acetylglucosamine
Regulog: NagR - Chloroflexia
Statistics of regulated genes:
- Genes 9
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -418
Score: 4.9
Sequence: GTAATGGTTCATTGGGTTAACAA
Position: -23
Score: 4.3
Sequence: TAGTAAATTCATTGGAATAAGTT
Locus tag: Haur_1182
Name: nagR
Funciton: Predicted N-acetyl-glucosamine repressor, ROK family
Locus tag: Haur_1181
Name: nagK
Funciton: Predicted N-acetyl-glucosamine kinase, ROK family (EC 2.7.1.59)
Locus tag: Haur_1180
Name: chbA
Funciton: Predicted chitobiose ABC transporter, periplasmic component
Locus tag: Haur_1179
Name: chbB
Funciton: Predicted chitobiose ABC transporter, permease component 1
Locus tag: Haur_1178
Name: chbC
Funciton: Predicted chitobiose ABC transporter, permease component 2
Locus tag: Haur_1177
Name: hex
Funciton: Beta-hexosaminidase (EC 3.2.1.52)
Locus tag: Haur_1176
Name: null
Funciton: hypothetical protein
Locus tag: Haur_1175
Name: nagA
Funciton: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
Locus tag: Haur_1174
Name: nagB
Funciton: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)
nagR
Predicted N-acetyl-glucosamine repressor, ROK family
nagK
Predicted N-acetyl-glucosamine kinase, ROK family (EC 2.7.1.59)
chbA
Predicted chitobiose ABC transporter, periplasmic component
chbB
Predicted chitobiose ABC transporter, permease component 1
chbC
Predicted chitobiose ABC transporter, permease component 2
hex
Beta-hexosaminidase (EC 3.2.1.52)
hypothetical protein
nagA
N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
nagB
Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD