Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of NagR in Chloroflexus sp. Y-400-fl

Properties
Regulator type: Transcription factor
TF locus tag: Chy400_1208
Regulator family: ROK
Regulation mode:
Biological process: N-acetylglucosamine utilization
Effector: N-acetylglucosamine
Regulog: NagR - Chloroflexia
Statistics of regulated genes:
- Genes 9
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -39
Score: 6.8
Sequence: TTGTTAGTTCATTGGACTATCTA
Locus tag: Chy400_1208
Name: nagR
Funciton: Predicted N-acetyl-glucosamine repressor, ROK family
Locus tag: Chy400_1209
Name: age
Funciton: N-acylglucosamine 2-epimerase (EC 5.1.3.8)
Locus tag: Chy400_1210
Name: null
Funciton: hypothetical protein
Locus tag: Chy400_1211
Name: chiE
Funciton: Predicted chitobiose ABC transport system, sugar-binding protein (Thermotoga-like)
Locus tag: Chy400_1212
Name: chiF
Funciton: Predicted chitobiose ABC transport system, permease protein 1 (Thermotoga-like)
Locus tag: Chy400_1213
Name: chiG
Funciton: Predicted chitobiose ABC transport system, permease protein 2 (Thermotoga-like)
Locus tag: Chy400_1214
Name: null
Funciton: glycoside hydrolase family 38
Locus tag: Chy400_1215
Name: hex2
Funciton: Beta-hexosaminidase
Locus tag: Chy400_1216
Name: nagB
Funciton: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)
nagR
Predicted N-acetyl-glucosamine repressor, ROK family
age
N-acylglucosamine 2-epimerase (EC 5.1.3.8)
hypothetical protein
chiE
Predicted chitobiose ABC transport system, sugar-binding protein (Thermotoga-like)
chiF
Predicted chitobiose ABC transport system, permease protein 1 (Thermotoga-like)
chiG
Predicted chitobiose ABC transport system, permease protein 2 (Thermotoga-like)
glycoside hydrolase family 38
hex2
Beta-hexosaminidase
nagB
Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD