Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Caur_3448 in Herpetosiphon aurantiacus ATCC 23779

Properties
Regulator type: Transcription factor
TF locus tag: Haur_0778
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Regulog: Caur_3448 - Chloroflexia
Statistics of regulated genes:
- Genes 2
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 9 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -32
Score: 5.7
Sequence: CTATTTAAACGTTTAAATAG
Locus tag: Haur_0778
Name: Caur_3448
Funciton: Hypothetical sugar utilization transcriptional regulator , LacI family
Locus tag: Haur_0777
Name: ggtA
Funciton: Multiple sugar ABC transporter, ATP-binding protein, orthologs of ggtA-Synechocystis
Caur_3448
Hypothetical sugar utilization transcriptional regulator , LacI family
ggtA
Multiple sugar ABC transporter, ATP-binding protein, orthologs of ggtA-Synechocystis
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD