Regulon of Caur_3448 in Herpetosiphon aurantiacus ATCC 23779
| Regulator type: | Transcription factor |
| TF locus tag: | Haur_0778 |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Regulog: | Caur_3448 - Chloroflexia |
| Statistics of regulated genes: | |
| - Genes | 2 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Chloroflexi
- By TF family - LacI
- By pathway - Sugar utilization
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -32
Score: 5.7 Sequence: CTATTTAAACGTTTAAATAG
Locus tag: Haur_0778
Name: Caur_3448 Funciton: Hypothetical sugar utilization transcriptional regulator , LacI family
Locus tag: Haur_0777
Name: ggtA Funciton: Multiple sugar ABC transporter, ATP-binding protein, orthologs of ggtA-Synechocystis |
|||
|
Caur_3448
|
Hypothetical sugar utilization transcriptional regulator , LacI family
|
||
|
ggtA
|
Multiple sugar ABC transporter, ATP-binding protein, orthologs of ggtA-Synechocystis
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |