Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of YxeR in Oenococcus oeni PSU-1

Properties
Regulator type: Transcription factor
TF locus tag: OEOE_0733
Regulator family: TetR
Regulation mode: repressor
Biological process: Antibiotic resistance
Effector:
Regulog: YxeR - Lactobacillaceae
Statistics of regulated genes:
- Genes 3
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 20 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -72
Score: 3.6
Sequence: AAATTGACGCCGTGTCACCAT
Position: -35
Score: 4.9
Sequence: TTAGTGACGTGGTGTCACTTA
Locus tag: OEOE_0733
Name: yxeR
Funciton: Predicted antibiotic resistance transcriptional reguator, TetR family
Locus tag: OEOE_0734
Name: yxeA
Funciton: Predicted antimicrobial peptide transporter, permease protein
Locus tag: OEOE_0735
Name: yxeB
Funciton: Predicted antimicrobial peptide transporter, ATP-binding protein
yxeR
Predicted antibiotic resistance transcriptional reguator, TetR family
yxeA
Predicted antimicrobial peptide transporter, permease protein
yxeB
Predicted antimicrobial peptide transporter, ATP-binding protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD