Regulon of YxeR in Lactobacillus acidophilus NCFM
Regulator type: | Transcription factor |
TF locus tag: | LBA1840 |
Regulator family: | TetR |
Regulation mode: | repressor |
Biological process: | Antibiotic resistance |
Effector: | |
Regulog: | YxeR - Lactobacillaceae |
Statistics of regulated genes: | |
- Genes | 3 |
- Operons | 1 |
Visualization: | |
![]() |
Allows to visualize regulon content in the context of metabolic pathways |

Member of regulog collections
- By taxonomy - Lactobacillaceae
- By TF family - TetR
- By pathway - Antibiotic resistance
Locus Tag | Name | Function | |
---|---|---|---|
Position: -81
Score: 3.6 Sequence: TTATTGACAACTCGTCACAAT
Locus tag: LBA1840
Name: yxeR Funciton: Predicted antibiotic resistance transcriptional reguator, TetR family
Locus tag: LBA1839
Name: yxeA Funciton: Predicted antimicrobial peptide transporter, permease protein
Locus tag: LBA1838
Name: yxeB Funciton: Predicted antimicrobial peptide transporter, ATP-binding protein |
|||
yxeR
|
Predicted antibiotic resistance transcriptional reguator, TetR family
|
||
yxeA
|
Predicted antimicrobial peptide transporter, permease protein
|
||
yxeB
|
Predicted antimicrobial peptide transporter, ATP-binding protein
|
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |