Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of AguR in Pediococcus pentosaceus ATCC 25745

Properties
Regulator type: Transcription factor
TF locus tag:
Regulator family: RpiR
Regulation mode:
Biological process: Agmatine utilization
Effector:
Regulog: AguR - Lactobacillaceae
Statistics of regulated genes:
- Genes 6
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -145
Score: 6.2
Sequence: AAATGAAACATGTTTCATGA
Locus tag: PEPE_0189
Name: ptcA
Funciton: Putrescine carbamoyltransferase (EC 2.1.3.6)
Locus tag: PEPE_0190
Name: aguD
Funciton: Agmatine/putrescine antiporter, associated with agmatine catabolism
Locus tag: PEPE_0191
Name: aguA1
Funciton: Agmatine deiminase (EC 3.5.3.12)
Locus tag: PEPE_0192
Name: aguC
Funciton: Carbamate kinase (EC 2.7.2.2)
Locus tag: PEPE_0193
Name: aguA2
Funciton: Agmatine deiminase (EC 3.5.3.12)
Locus tag: PEPE_0194
Name: aguR
Funciton: Predicted agmatine utilization transcriptional regulator AguR, RpiR family
ptcA
Putrescine carbamoyltransferase (EC 2.1.3.6)
aguD
Agmatine/putrescine antiporter, associated with agmatine catabolism
aguA1
Agmatine deiminase (EC 3.5.3.12)
aguC
Carbamate kinase (EC 2.7.2.2)
aguA2
Agmatine deiminase (EC 3.5.3.12)
aguR
Predicted agmatine utilization transcriptional regulator AguR, RpiR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD