Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of AguR in Lactobacillus sakei subsp. sakei 23K

Properties
Regulator type: Transcription factor
TF locus tag: LSA0073
Regulator family: RpiR
Regulation mode:
Biological process: Agmatine utilization
Effector:
Regulog: AguR - Lactobacillaceae
Statistics of regulated genes:
- Genes 7
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -121
Score: 4.8
Sequence: AAATGGAACAAAATACACAT
Locus tag: LSA0067
Name: ptcA
Funciton: Putrescine carbamoyltransferase (EC 2.1.3.6)
Locus tag: LSA0068
Name: aguD
Funciton: Agmatine/putrescine antiporter, associated with agmatine catabolism
Locus tag: LSA0069
Name: aguD
Funciton: Agmatine/putrescine antiporter, associated with agmatine catabolism
Locus tag: LSA0070
Name: aguA1
Funciton: Agmatine deiminase (EC 3.5.3.12)
Locus tag: LSA0071
Name: aguC
Funciton: Carbamate kinase (EC 2.7.2.2)
Locus tag: LSA0072
Name: aguA2
Funciton: Agmatine deiminase (EC 3.5.3.12)
Locus tag: LSA0073
Name: aguR
Funciton: Predicted agmatine utilization transcriptional regulator AguR, RpiR family
ptcA
Putrescine carbamoyltransferase (EC 2.1.3.6)
aguD
Agmatine/putrescine antiporter, associated with agmatine catabolism
aguD
Agmatine/putrescine antiporter, associated with agmatine catabolism
aguA1
Agmatine deiminase (EC 3.5.3.12)
aguC
Carbamate kinase (EC 2.7.2.2)
aguA2
Agmatine deiminase (EC 3.5.3.12)
aguR
Predicted agmatine utilization transcriptional regulator AguR, RpiR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD