Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of AguR in Lactobacillus brevis ATCC 367

Properties
Regulator type: Transcription factor
TF locus tag: LVIS_2205
Regulator family: RpiR
Regulation mode:
Biological process: Agmatine utilization
Effector:
Regulog: AguR - Lactobacillaceae
Statistics of regulated genes:
- Genes 6
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -157
Score: 5.6
Sequence: GAATGAAACATGTGTCACCA
Locus tag: LVIS_2210
Name: ptcA
Funciton: Putrescine carbamoyltransferase (EC 2.1.3.6)
Locus tag: LVIS_2209
Name: aguD
Funciton: Agmatine/putrescine antiporter, associated with agmatine catabolism
Locus tag: LVIS_2208
Name: aguA1
Funciton: Agmatine deiminase (EC 3.5.3.12)
Locus tag: LVIS_2207
Name: aguC
Funciton: Carbamate kinase (EC 2.7.2.2)
Locus tag: LVIS_2206
Name: aguA2
Funciton: Agmatine deiminase (EC 3.5.3.12)
Locus tag: LVIS_2205
Name: aguR
Funciton: Predicted agmatine utilization transcriptional regulator AguR, RpiR family
ptcA
Putrescine carbamoyltransferase (EC 2.1.3.6)
aguD
Agmatine/putrescine antiporter, associated with agmatine catabolism
aguA1
Agmatine deiminase (EC 3.5.3.12)
aguC
Carbamate kinase (EC 2.7.2.2)
aguA2
Agmatine deiminase (EC 3.5.3.12)
aguR
Predicted agmatine utilization transcriptional regulator AguR, RpiR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD