Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of FlpA in Lactobacillus salivarius subsp. salivarius UCC118

Properties
Regulator type: Transcription factor
TF locus tag: LSL_1782
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Heavy metal resistance
Effector: Oxygen
Regulog: FlpA - Lactobacillaceae
Statistics of regulated genes:
- Genes 4
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 32 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -210
Score: 5.6
Sequence: AACTTGATAGCCATAAATTT
Position: -88
Score: 5.7
Sequence: AACTTGATGTCAGTCAATTA
Locus tag: LSL_1786
Name: cadA
Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC:3.6.3.-)
cadA
Lead, cadmium, zinc and mercury transporting ATPase (EC:3.6.3.-)

Position: -129
Score: 5.9
Sequence: AACTTGATATGCGTCAATTT
Locus tag: LSL_1784
Name: copZ
Funciton: Copper chaperone
copZ
Copper chaperone

Position: -89
Score: 5.6
Sequence: TTCTTGATGTGCATCAATTT
Locus tag: LSL_1782
Name: flpA
Funciton: Heavy metal resistance transcriptional regulator FlpA, Crp family
flpA
Heavy metal resistance transcriptional regulator FlpA, Crp family

Position: -118
Score: 5.5
Sequence: TTCTTGATGAGCGTCAATTT
Locus tag: LSL_1781
Name: dps
Funciton: Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
dps
Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD