Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of FlpA in Lactobacillus reuteri JCM 1112

Properties
Regulator type: Transcription factor
TF locus tag: LAR_1338
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Heavy metal resistance
Effector: Oxygen
Regulog: FlpA - Lactobacillaceae
Statistics of regulated genes:
- Genes 3
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 32 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -69
Score: 5.7
Sequence: AAATTGATGATAATCAATTT
Locus tag: LAR_1340
Name: copZ
Funciton: Copper chaperone
copZ
Copper chaperone

Position: -298
Score: 5.7
Sequence: AAATTGATGATAATCAATTT
Locus tag: LAR_1339
Name: dps
Funciton: Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
Locus tag: LAR_1338
Name: flpA
Funciton: Heavy metal resistance transcriptional regulator FlpA, Crp family
dps
Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
flpA
Heavy metal resistance transcriptional regulator FlpA, Crp family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD