Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of FlpA in Lactobacillus johnsonii NCC 533

Properties
Regulator type: Transcription factor
TF locus tag: LJ1693
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Heavy metal resistance
Effector: Oxygen
Regulog: FlpA - Lactobacillaceae
Statistics of regulated genes:
- Genes 2
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 32 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -82
Score: 6
Sequence: AAATTGACGATCATCAAGTT
Locus tag: LJ1695
Name: copZ
Funciton: Copper chaperone
copZ
Copper chaperone

Position: -75
Score: 5.2
Sequence: ATCTTGATAATAGTCAAGTC
Locus tag: LJ1696
Name: cadA
Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC:3.6.3.-)
cadA
Lead, cadmium, zinc and mercury transporting ATPase (EC:3.6.3.-)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD