Regulon of CzcR2 in Lactobacillus rhamnosus GG
| Regulator type: | Transcription factor |
| TF locus tag: | LGG_02418 |
| Regulator family: | ArsR |
| Regulation mode: | |
| Biological process: | Zinc resistance; Cobalt resistance; Cadmium resistance |
| Effector: | |
| Regulog: | CzcR2 - Lactobacillaceae |
| Statistics of regulated genes: | |
| - Genes | 2 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Lactobacillaceae
- By trascription factor - CzrA
- By TF family - ArsR
- By pathway - Zinc resistance
- By pathway - Cobalt resistance
- By pathway - Cadmium resistance
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -68
Score: 6 Sequence: TTATGTTGACATTAACATAT
Locus tag: LGG_02417
Name: czcX Funciton: Predicted cobalt-zinc-cadmium resistance protein
Locus tag: LGG_02418
Name: czcR2 Funciton: Cobalt-zinc-cadmium resistance transcriptional regulator CzcR1, ArsR family |
|||
|
czcX
|
Predicted cobalt-zinc-cadmium resistance protein
|
||
|
czcR2
|
Cobalt-zinc-cadmium resistance transcriptional regulator CzcR1, ArsR family
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |