Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CzcR2 in Lactobacillus rhamnosus GG

Properties
Regulator type: Transcription factor
TF locus tag: LGG_02418
Regulator family: ArsR
Regulation mode:
Biological process: Zinc resistance; Cobalt resistance; Cadmium resistance
Effector:
Regulog: CzcR2 - Lactobacillaceae
Statistics of regulated genes:
- Genes 2
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -68
Score: 6
Sequence: TTATGTTGACATTAACATAT
Locus tag: LGG_02417
Name: czcX
Funciton: Predicted cobalt-zinc-cadmium resistance protein
Locus tag: LGG_02418
Name: czcR2
Funciton: Cobalt-zinc-cadmium resistance transcriptional regulator CzcR1, ArsR family
czcX
Predicted cobalt-zinc-cadmium resistance protein
czcR2
Cobalt-zinc-cadmium resistance transcriptional regulator CzcR1, ArsR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD