Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CzcR2 in Lactobacillus brevis ATCC 367

Properties
Regulator type: Transcription factor
TF locus tag: LVIS_0395
Regulator family: ArsR
Regulation mode:
Biological process: Zinc resistance; Cobalt resistance; Cadmium resistance
Effector:
Regulog: CzcR2 - Lactobacillaceae
Statistics of regulated genes:
- Genes 2
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -2
Score: 5.9
Sequence: ATATGAATATGATAACATAT
Position: 14
Score: 6.1
Sequence: ATATGTTGAAAATAACATAT
Locus tag: LVIS_0396
Name: cadD2
Funciton: Predicted permease, cadmium resistance protein
cadD2
Predicted permease, cadmium resistance protein

Position: -56
Score: 6.1
Sequence: ATATGTTATTTTCAACATAT
Position: -40
Score: 5.9
Sequence: ATATGTTATCATATTCATAT
Locus tag: LVIS_0395
Name: czcR2
Funciton: Cobalt-zinc-cadmium resistance transcriptional regulator CzcR1, ArsR family
czcR2
Cobalt-zinc-cadmium resistance transcriptional regulator CzcR1, ArsR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD