Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CzcR1 in Lactobacillus reuteri JCM 1112

Properties
Regulator type: Transcription factor
TF locus tag: LAR_1706
Regulator family: ArsR
Regulation mode: repressor
Biological process: Zinc resistance; Cobalt resistance; Cadmium resistance
Effector:
Regulog: CzcR1 - Lactobacillaceae
Statistics of regulated genes:
- Genes 2
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -60
Score: 6.5
Sequence: ATATATCAAATTCGATATAT
Position: -33
Score: 6.3
Sequence: GTATATCGAATTTGATATAT
Locus tag: LAR_1705
Name: cadD1
Funciton: Predicted permease, cadmium resistance protein
Locus tag: LAR_1706
Name: czcR1
Funciton: Cobalt-zinc-cadmium resistance transcriptional regulator CzcR1, ArsR family
cadD1
Predicted permease, cadmium resistance protein
czcR1
Cobalt-zinc-cadmium resistance transcriptional regulator CzcR1, ArsR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD